E. Charafe-jauffret, C. Ginestier, F. Iovino, J. Wicinski, N. Cervera et al., Breast cancer cell lines contain functional cancer stem cells with metastatic capacity and a distinct molecular signature, Cancer Res, vol.69, pp.1302-1313, 2009.
URL : https://hal.archives-ouvertes.fr/hal-01431954

M. Cordenonsi, F. Zanconato, L. Azzolin, M. Forcato, A. Rosato et al.,

C. J. Creighton, X. Li, M. Landis, J. M. Dixon, V. M. Neumeister et al., Residual breast cancers after conventional therapy display mesenchymal as well as tumor-initiating features, Proc. Natl. Acad. Sci. U S A, vol.106, pp.13820-13825, 2009.

L. E. Dow, J. S. Kauffman, J. Caddy, K. Zarbalis, A. S. Peterson et al., The tumoursuppressor Scribble dictates cell polarity during directed epithelial migration: regulation of Rho GTPase recruitment to the leading edge, Oncogene, vol.26, pp.2272-2282, 2007.

R. El-helou, G. Pinna, O. Cabaud, J. Wicinski, R. Bhajun et al., miR-600 acts as a bimodal switch that regulates breast cancer stem cell fate through WNT signaling, Cell Rep, vol.18, pp.2256-2268, 2017.
URL : https://hal.archives-ouvertes.fr/hal-01789620

M. E. Feigin, S. D. Akshinthala, K. Araki, A. Z. Rosenberg, L. B. Muthuswamy et al., Mislocalization of the cell polarity protein scribble promotes mammary tumorigenesis and is associated with basal breast cancer, Cancer Res, vol.74, pp.3180-3194, 2014.

M. M. Fischer, B. Cancilla, V. P. Yeung, F. Cattaruzza, C. Chartier et al., WNT antagonists exhibit unique combinatorial antitumor activity with taxanes by potentiating mitotic cell death, 2017.

C. Ginestier, M. H. Hur, E. Charafe-jauffret, F. Monville, J. Dutcher et al., ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome, Cell Stem Cell, vol.1, pp.555-567, 2007.
URL : https://hal.archives-ouvertes.fr/hal-01431968

N. J. Godde, J. M. Sheridan, L. K. Smith, H. B. Pearson, K. L. Britt et al., Scribble modulates the MAPK/Fra1 pathway to disrupt luminal and ductal integrity and suppress tumour formation in the mammary gland, PLoS Genet, vol.10, p.1004323, 2014.

Y. Li, B. Zhou, J. Dai, R. Liu, and Z. G. Han, Aberrant upregulation of LRRC1 contributes to human hepatocellular carcinoma, Mol. Biol. Rep, vol.40, pp.4543-4551, 2013.

E. Lim, D. Wu, B. Pal, T. Bouras, M. L. Asselin-labat et al., , 2010.

, Transcriptome analyses of mouse and human mammary cell subpopulations reveal multiple conserved genes and pathways, Breast Cancer Res, vol.12, p.21

H. Liu, S. Wang, W. Hang, J. Gao, W. Zhang et al., LET-413/Erbin acts as a RAB-5 effector to promote RAB-10 activation during endocytic recycling, J. Cell Biol, vol.217, pp.299-314, 2018.

S. A. Mani, W. Guo, M. J. Liao, E. N. Eaton, A. Ayyanan et al., The epithelial-mesenchymal transition generates cells with properties of stem cells, Cell, vol.133, pp.704-715, 2008.

A. P. Morel, C. Ginestier, R. M. Pommier, O. Cabaud, E. Ruiz et al., A stemness-related ZEB1-MSRB3 axis governs cellular pliancy and breast cancer genome stability, Nat. Med, vol.23, pp.568-578, 2017.
URL : https://hal.archives-ouvertes.fr/hal-01788395

C. Navarro, S. Nola, S. Audebert, M. J. Santoni, J. P. Arsanto et al., Junctional recruitment of mammalian Scribble relies on E-cadherin engagement, Oncogene, vol.24, pp.4330-4339, 2005.
URL : https://hal.archives-ouvertes.fr/hal-00118710

C. Niehrs, The complex world of WNT receptor signalling, Nat. Rev. Mol. Cell Biol, vol.13, pp.767-779, 2012.

S. Nola, M. Sebbagh, S. Marchetto, N. Osmani, C. Nourry et al., Scrib regulates PAK activity during the cell migration process, Hum. Mol. Genet, vol.17, pp.3552-3565, 2008.

R. Nusse and H. Clevers, Wnt/beta-catenin signaling, disease, and emerging therapeutic modalities, Cell, vol.169, pp.985-999, 2017.

Y. Ono, Y. Urata, S. Goto, S. Nakagawa, P. O. Humbert et al., Muscle stem cell fate is controlled by the cell-polarity protein Scrib, Cell Rep, vol.10, pp.1135-1148, 2015.

S. Pece, D. Tosoni, S. Confalonieri, G. Mazzarol, M. Vecchi et al., Biological and molecular heterogeneity of breast cancers correlates with their cancer stem cell content, Cell, vol.140, pp.62-73, 2010.

, Stem Cell Reports j, vol.11, 1040.

A. Prat, J. S. Parker, O. Karginova, C. Fan, C. Livasy et al., Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer, Breast Cancer Res, vol.12, p.68, 2010.

H. Saito, M. J. Santoni, J. P. Arsanto, F. Jaulin-bastard, A. Le-bivic et al., Lano, a novel LAP protein directly connected to MAGUK proteins in epithelial cells, J. Biol. Chem, vol.276, pp.32051-32055, 2001.

M. J. Santoni, P. Pontarotti, D. Birnbaum, and J. P. Borg, , 2002.

, The LAP family: a phylogenetic point of view, Trends Genet, vol.18, pp.494-497

M. Sebbagh and J. P. Borg, Insight into planar cell polarity, Exp. Cell Res, vol.328, pp.284-295, 2014.
DOI : 10.1016/j.yexcr.2014.09.005

J. H. Taube, J. I. Herschkowitz, K. Komurov, A. Y. Zhou, S. Gupta et al., Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplastic breast cancer subtypes, Proc. Natl. Acad. Sci. U S A, vol.107, pp.15449-15454, 2010.
DOI : 10.1073/pnas.1004900107
URL : http://www.pnas.org/content/107/35/15449.full.pdf

J. E. Visvader and G. J. Lindeman, Cancer stem cells: current status and evolving complexities, Cell Stem Cell, vol.10, pp.717-728, 2012.
DOI : 10.1016/j.stem.2012.05.007
URL : https://doi.org/10.1016/j.stem.2012.05.007

F. X. Yu, B. Zhao, and K. L. Guan, Hippo pathway in organ size control, tissue homeostasis, and cancer, Cell, vol.163, pp.811-828, 2015.
DOI : 10.1016/j.cell.2015.10.044
URL : https://doi.org/10.1016/j.cell.2015.10.044

L. Zhan, A. Rosenberg, K. C. Bergami, M. Yu, Z. Xuan et al., Deregulation of scribble promotes mammary tumorigenesis and reveals a role for cell polarity in carcinoma, Cell, vol.135, pp.865-878, 2008.

, Stem Cell Reports j, vol.11, 1040.

, Stem Cell Reports, vol.11

, Supplemental Information The SCRIB Paralog LANO/LRRC1 Regulates Breast Cancer Stem Cell Fate through WNT/b-Catenin Signaling

L. Lopez-almeida, M. Sebbagh, F. Bertucci, P. Finetti, J. Wicinski et al., Santoni The (Lano -/-) were characterized by PCR and sequencing of the remaining genomic region. Finally, absence of Lano protein expression was tested biochemically on recombinant tissues. Primers used for routine genotyping of mice biopsies are the following: Cre detection

, WT gene [LanoWTF: CTTAGTTCAGGGAGTGGTCG

. Lanowt,

, Floxed Lano/LRRC1 gene [LanoCKO(1F):TTCTGCAGTTGAGAGGCCCATAGT

. Lanocko,

, Lano/LRRC1 excised gene [LanoCKO(1F)

. Lanowt,

, Mice were housed under sterile conditions with sterilized food and water provided ad libitum and maintained on a 12-h light and 12-h dark cycle. 1×10 6 luciferase-expressing SUM149 cells suspended in 50% phenol red-free Matrigel (Becton Dickinson Bioscience) were inoculated in the mammary fat pad in 3 cohorts of 8 mice. Tumor growth was monitored by measuring with a digital caliper and calculating tumor volume (length × width 2 × ?/6). All animals were randomly assigned to treatment groups, All experiments were performed in agreement with the French Guidelines for animal handling and approved by local ethics committee APAFIS#10719-2017071709337799. NOD/SCID/?c null mice (NSG) were obtained from Charles River

. Photonimager, After completion of the analysis, autopsy of mice was performed, and organ luminescence was assessed. For the limiting dilution assay, 100; 1,000; 100,000 cells were injected as described above in the mammary fat pad of NGS mice corresponding (9 cohorts of 4 mice). Estimation of the breast CSC frequency was calculated using ELDA algorithm

R. El-helou, G. Pinna, O. Cabaud, J. Wicinski, R. Bhajun et al., miR-600 Acts as a Bimodal Switch that Regulates Breast Cancer Stem Cell Fate through WNT Signaling, Cell Rep, vol.18, pp.2256-2268, 2017.
URL : https://hal.archives-ouvertes.fr/hal-02095577

P. Finetti, N. Cervera, E. Charafe-jauffret, C. Chabannon, C. Charpin et al., Sixteen-kinase gene expression identifies luminal breast cancers with poor prognosis, Cancer Res, vol.68, pp.767-776, 2008.
DOI : 10.1158/0008-5472.can-07-5516
URL : http://cancerres.aacrjournals.org/content/68/3/767.full.pdf

J. S. Parker, M. Mullins, M. C. Cheang, S. Leung, D. Voduc et al., Supervised risk predictor of breast cancer based on intrinsic subtypes, J Clin Oncol, vol.27, pp.1160-1167, 2009.
DOI : 10.1200/jco.2008.18.1370
URL : http://europepmc.org/articles/pmc2667820?pdf=render

H. Saito, M. J. Santoni, J. P. Arsanto, F. Jaulin-bastard, A. Le-bivic et al., Lano, a novel LAP protein directly connected to MAGUK proteins in epithelial cells, J Biol Chem, vol.276, pp.32051-32055, 2001.

M. Sebbagh, M. J. Santoni, B. Hall, J. P. Borg, and M. A. Schwartz, Regulation of LKB1/STRAD localization and function by E-cadherin, Curr Biol, vol.19, pp.37-42, 2009.