Correction: Response to Mechanical Stress Is Mediated by the TRPA Channel Painless in the Drosophila Heart - Archive ouverte HAL Access content directly
Journal Articles PLoS Genetics Year : 2011

Correction: Response to Mechanical Stress Is Mediated by the TRPA Channel Painless in the Drosophila Heart

Sébastien Sénatore
  • Function : Author
Vatrapu Rami Reddy
  • Function : Author
Michel Sémériva
  • Function : Author

Abstract

The following text replaces the corresponding text in the Materials and Methods section, which incorrectly described UAS>painlessFL constructs: "The full length painless cDNA from BDGP gold collection (RE03641) has been used as a template. In this cDNA, a TN10 transposon was found to be inserted following nucleotide 1795. To remove the TN10 transposon, we have used a two step PCR strategy. Painless sequences flanking the TN10 sequence were amplified using primers couples (forward/reverse): caaggagacgcagcgcgtcttagccg/ggtaccaacatttgaaattaaatatttactc and gcggccgcggtcgttgtctggatattaa /cggctaagacgcgctgcgtctccttg. Next, the products of these two PCR were mixed to use as a new template and amplified using the following primers couple (forward/reverse): ttaatagcggccgcggtcgttgtctggatattaa/ttaataggtaccaacatttgaaattaaatatttactc. NotI and KpnI restriction sites were respectively included in those forward and reverse primers. The PCR product was verified by sequencing and revealed a single silent mutation at nucleotide 1605 changing C in T. It was subsequently cloned into a KpnI/NotI-cut pUAST-attb transformation vector [46]. This pUAST-attb-pain is available on request."

Dates and versions

hal-01619090 , version 1 (19-10-2017)

Identifiers

Cite

Sébastien Sénatore, Vatrapu Rami Reddy, Michel Sémériva, Laurent Perrin, Nathalie Lalevee. Correction: Response to Mechanical Stress Is Mediated by the TRPA Channel Painless in the Drosophila Heart. PLoS Genetics, 2011, 7 (2), ⟨10.1371/annotation/67b1f487-ed62-43b1-9010-ea89cf246b5d⟩. ⟨hal-01619090⟩

Collections

CNRS UNIV-AMU IBDM
65 View
0 Download

Altmetric

Share

Gmail Facebook Twitter LinkedIn More